FZD8 Knockout Cell Line - CD BioSciences

service-banner

FZD8 Knockout Cell Line

FZD8 Knockout Cell Line

SPL-01446

Size Price
1 Unit Online Inquiry
Description
17bp deletion
Target Information
Target Name FZD8
Gene Abbr. FZD8
Gene ID 8325
Full Name frizzled class receptor 8
Alias FZ-8, hFZ8
Species Human
Genomic Locus chr10:35641120
Transcript NM_031866
WT Expression Level 0.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of FZD8.
Description 17bp deletion
Parental Cell Line C631
Guide RNA Sequence GCGGCTTCTTGTAGTCCTCT
PCR Primer Forward: TGTCAGGGTTGCCTTGCTC
Reverse: GTTCAACCACGACACGCAAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.