Fzd5 cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Fzd5 cDNA ORF Clone, Mouse, N-His tag

Fzd5 cDNA ORF Clone, Mouse, N-His tag

SPD-05773

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse frizzled homolog 5 (Drosophila) with N terminal His tag.
Target Information
Species Mouse
Target Name Frizzled-5
Gene Abbr. Fzd5
Gene ID 14367
Full Name frizzled class receptor 5
Alias 5330434N09Rik, AI427138, Fz-5, Fz5, mFz5
Introduction Frizzled (Fzd) belongs to the seven transmembrane-spanning G-protein-coupled receptor (GPCR) superfamily. Fzds have a large extracellular N-terminal region containing a cysteine-rich domain (CRD), which is involved in binding to Wnt proteins. The intracellular C-terminus binds to the PDZ domain of Dvl proteins, a major signaling component downstream of Fzd. Wnt proteins bind to Fzd and the co-receptors LRP5 or LPR6, and activate Wnt/β-catenin pathway through inhibiting phosphorylation of β-catenin by GSK3-β. In addition to this canonical Wnt/β-catenin pathway, some Wnt proteins can also activate the Fzd/Ca2+ pathway and Fzd/PCP (planar cell polarity) pathway. The mammalian Fzd subfamily has 10 members (Fzd1 to Fzd10) and they may mediate signaling through different pathways. Some Fzds can also bind to other secreted proteins, like Norrin and R-Spondin.
Product Details
Description Full length Clone DNA of Mouse frizzled homolog 5 (Drosophila) with N terminal His tag.
NCBI Ref Seq NM_001042659.1
RefSeq ORF Size 1758 bp
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.