Online Inquiry
Fzd4 cDNA ORF Clone, Rat, N-His tag
SPD-05752
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat frizzled homolog 4 (Drosophila) with N terminal His tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | Frizzled-4 |
Gene Abbr. | Fzd4 |
Gene ID | 64558 |
Full Name | frizzled class receptor 4 |
Introduction | This gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This protein may play a role as a positive regulator of the Wingless type MMTV integration site signaling pathway. A transcript variant retaining intronic sequence and encoding a shorter isoform has been described, however, its expression is not supported by other experimental evidence. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat frizzled homolog 4 (Drosophila) with N terminal His tag. |
NCBI Ref Seq | NM_022623.1 |
RefSeq ORF Size | 1617 bp |
Vector | pCMV3-SP-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.