Fzd4 cDNA ORF Clone, Rat, N-FLAG tag - CD BioSciences

service-banner

Fzd4 cDNA ORF Clone, Rat, N-FLAG tag

Fzd4 cDNA ORF Clone, Rat, N-FLAG tag

SPD-05751

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat frizzled homolog 4 (Drosophila) with N terminal Flag tag.
Target Information
Species Rat
Target Name Frizzled-4
Gene Abbr. Fzd4
Gene ID 64558
Full Name frizzled class receptor 4
Introduction This gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This protein may play a role as a positive regulator of the Wingless type MMTV integration site signaling pathway. A transcript variant retaining intronic sequence and encoding a shorter isoform has been described, however, its expression is not supported by other experimental evidence. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Rat frizzled homolog 4 (Drosophila) with N terminal Flag tag.
NCBI Ref Seq NM_022623.1
RefSeq ORF Size 1617 bp
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.