Fzd4 cDNA ORF Clone, Mouse, N-HA tag - CD BioSciences

service-banner

Fzd4 cDNA ORF Clone, Mouse, N-HA tag

Fzd4 cDNA ORF Clone, Mouse, N-HA tag

SPD-05764

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse frizzled homolog 4 (Drosophila) with N terminal HA tag.
Target Information
Species Mouse
Target Name Frizzled-4
Gene Abbr. Fzd4
Gene ID 14366
Full Name frizzled class receptor 4
Alias Fz4
Introduction This gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This protein may play a role as a positive regulator of the Wingless type MMTV integration site signaling pathway. A transcript variant retaining intronic sequence and encoding a shorter isoform has been described, however, its expression is not supported by other experimental evidence. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Mouse frizzled homolog 4 (Drosophila) with N terminal HA tag.
NCBI Ref Seq NM_008055.4
RefSeq ORF Size 1614 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.