FZD4 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

FZD4 cDNA ORF Clone, Human, untagged

FZD4 cDNA ORF Clone, Human, untagged

SPD-05766

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human frizzled class receptor 4
Target Information
Species Human
Target Name Frizzled-4
Gene Abbr. FZD4
Gene ID 8322
Full Name frizzled class receptor 4
Alias CD344, EVR1, FEVR, FZD4S, Fz-4
Introduction This gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This protein may play a role as a positive regulator of the Wingless type MMTV integration site signaling pathway. A transcript variant retaining intronic sequence and encoding a shorter isoform has been described, however, its expression is not supported by other experimental evidence. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Human frizzled class receptor 4
NCBI Ref Seq NM_012193.3
RefSeq ORF Size 1614 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.61kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.