Online Inquiry
Fzd2 cDNA ORF Clone, Mouse, C-Myc tag
SPD-05737
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse frizzled homolog 2 (Drosophila) with C terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Frizzled-2 |
Gene Abbr. | Fzd2 |
Gene ID | 57265 |
Full Name | frizzled class receptor 2 |
Alias | AL033370, AW456835, Fz10, Fzd10, Mfz10 |
Introduction | Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The expression of the FZD2 gene appears to be developmentally regulated, with high levels of expression in fetal kidney and lung and in adult colon and ovary. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse frizzled homolog 2 (Drosophila) with C terminal Myc tag. |
NCBI Ref Seq | NM_020510.2 |
RefSeq ORF Size | 1713 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.