Fzd10 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Fzd10 cDNA ORF Clone, Mouse, untagged

Fzd10 cDNA ORF Clone, Mouse, untagged

SPD-05724

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse frizzled homolog 10 (Drosophila).
Target Information
Species Mouse
Target Name Frizzled-10
Gene Abbr. Fzd10
Gene ID 93897
Full Name frizzled class receptor 10
Alias Fz-10
Product Details
Description Full length Clone DNA of Mouse frizzled homolog 10 (Drosophila).
NCBI Ref Seq NM_175284.3
RefSeq ORF Size 1749 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.