Online Inquiry
FZD1 cDNA ORF Clone, Human, untagged
SPD-05714
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human frizzled family receptor 1. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Frizzled-1 |
| Gene Abbr. | FZD1 |
| Gene ID | 8321 |
| Full Name | frizzled class receptor 1 |
| Introduction | The Wnt genes encode a large family of glycoproteins that are essential in development and tissue maintenance. Members of the Frizzled family of proteins serve as receptors for the Wnt signaling pathway. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human frizzled family receptor 1. |
| NCBI Ref Seq | NM_003505.1 |
| RefSeq ORF Size | 1944 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.