Online Inquiry
FYN cDNA ORF Clone, Human, untagged
SPD-05842
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human FYN oncogene related to SRC, FGR, YES. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Fyn |
| Gene Abbr. | FYN |
| Gene ID | 2534 |
| Full Name | FYN proto-oncogene, Src family tyrosine kinase |
| Alias | SLK, SYN, p59-FYN |
| Introduction | The Src family of protein tyrosine kinases, which includes Src, Lyn, Fyn, Yes, Lck, Blk, and Hck, are important in the regulation of growth and differentiation of eukaryotic cells. Src activity is regulated by tyrosine phosphorylation at two sites, but with opposing effects. While phosphorylation at Tyr416 in the activation loop of the kinase domain upregulates enzyme activity, phosphorylation at Tyr527 in the carboxy-terminal tail by Csk renders the enzyme less active.Fyn is a 59 kDa member of the Src family of tyrosine kinases. The carboxy terminus of Fyn shares extensive amino acid sequence homology with Src, but is very different within the amino-terminal 81 amino acid residues. The Fyn protein is synthesized and N-myristoylated on cytosolic polysomes and then rapidly targeted to the plasma membrane, where it is palmitoylated. The corresponding sequences surrounding Tyr416 and Tyr527 of Src are conserved in Fyn and thus may be similarly regulated by phosphorylation. Dually acetylated Fyn clusters in caveolae-like membrane microdomains and can interact with a variety of other signaling molecules. Fyn's biological functions are diverse and include signaling via the T cell receptor, regulation of brain function and adhesion mediated signaling. Alteration of the levels of Fyn in appropriate target tissues may lead to better treatments for some related diseases. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human FYN oncogene related to SRC, FGR, YES. |
| NCBI Ref Seq | BC032496 |
| RefSeq ORF Size | 1449 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + XbaI (6.1kb + 1.45kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.