Online Inquiry
FTO Knockout Cell Line
SPL-01434
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
4bp deletion |
Target Information | |
---|---|
Target Name | FTO |
Gene Abbr. | FTO |
Gene ID | 79068 |
Full Name | FTO alpha-ketoglutarate dependent dioxygenase |
Alias | ALKBH9, BMIQ14, GDFD |
Species | Human |
Genomic Locus | chr16:53826294 |
Transcript | NM_001080432 |
WT Expression Level | 40.21 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene is a nuclear protein of the AlkB related non-haem iron and 2-oxoglutarate-dependent oxygenase superfamily but the exact physiological function of this gene is not known. Other non-heme iron enzymes function to reverse alkylated DNA and RNA damage by oxidative demethylation. Studies in mice and humans indicate a role in nervous and cardiovascular systems and a strong association with body mass index, obesity risk, and type 2 diabetes. [provided by RefSeq, Jul 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of FTO. |
Description | 4bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CACTTCATCTTGTCCGTTGT |
PCR Primer |
Forward: CTTCCTCAAGCTCAATGACTACCT Reverse: TATTACATACAGGGCTGCTTTTTCC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.