Online Inquiry
FTL Knockout Cell Line
SPL-01430
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 16bp deletion |
| Target Information | |
|---|---|
| Target Name | FTL |
| Gene Abbr. | FTL |
| Gene ID | 2512 |
| Full Name | ferritin light chain |
| Alias | LFTD, NBIA3 |
| Species | Human |
| Genomic Locus | chr19:48966312 |
| Transcript | NM_000146 |
| WT Expression Level | 632.79 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in this light chain ferritin gene are associated with several neurodegenerative diseases and hyperferritinemia-cataract syndrome. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of FTL. |
| Description | 16bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGCAGCTTTCATGGCGTCTG |
| PCR Primer |
Forward: ATACAAGCTGTCACATGTCTTTGTG Reverse: TGTGAAATGAGGCTCTGAAGGAAAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.