Online Inquiry
FSCN1 cDNA ORF Clone, Human, N-Myc tag
SPD-05497
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Fascin |
| Gene Abbr. | FSCN1 |
| Gene ID | 6624 |
| Full Name | fascin actin-bundling protein 1 |
| Alias | FAN1, HSN, SNL, p55 |
| Introduction | Fascin is a monomeric, globular protein that plays a central role in regulating the structure and function of the cortical actin cytoskeleton. Fascin promotes cross-linkage of parallel actin filaments during the formation of cell protrusions (lamellipodia and filopodia), and therefore plays an important role in regulating cell migration. It has been reported that fascin may also regulate filopodia formation by a mechanism independent of its actin-bundling functions though less is known about this mechanism of action. Research studies have shown that increased fascin expression is associated with increased motility and invasiveness of neoplastic cells, including breast, colon, prostate, and esophageal squamous cell carcinomas. Fascin binds to the armadillo-repeat domain of β-catenin in vitro and in vivo, and has been shown to co-localize with β-catenin and cadherins at the leading edge of migratory cells. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) with N terminal Myc tag. |
| NCBI Ref Seq | NM_003088.2 |
| RefSeq ORF Size | 1482 bp |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.