FSCN1 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

FSCN1 cDNA ORF Clone, Human, C-FLAG tag

FSCN1 cDNA ORF Clone, Human, C-FLAG tag

SPD-05490

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) with C terminal Flag tag.
Target Information
Species Human
Target Name Fascin
Gene Abbr. FSCN1
Gene ID 6624
Full Name fascin actin-bundling protein 1
Alias FAN1, HSN, SNL, p55
Introduction Fascin is a monomeric, globular protein that plays a central role in regulating the structure and function of the cortical actin cytoskeleton. Fascin promotes cross-linkage of parallel actin filaments during the formation of cell protrusions (lamellipodia and filopodia), and therefore plays an important role in regulating cell migration. It has been reported that fascin may also regulate filopodia formation by a mechanism independent of its actin-bundling functions though less is known about this mechanism of action. Research studies have shown that increased fascin expression is associated with increased motility and invasiveness of neoplastic cells, including breast, colon, prostate, and esophageal squamous cell carcinomas. Fascin binds to the armadillo-repeat domain of β-catenin in vitro and in vivo, and has been shown to co-localize with β-catenin and cadherins at the leading edge of migratory cells.
Product Details
Description Full length Clone DNA of Human fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) with C terminal Flag tag.
NCBI Ref Seq NM_003088.2
RefSeq ORF Size 1482 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.