Online Inquiry
FRS2 cDNA ORF Clone, Human, untagged
SPD-05800
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human fibroblast growth factor receptor substrate 2. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | FRS2 |
| Gene Abbr. | FRS2 |
| Gene ID | 10818 |
| Full Name | fibroblast growth factor receptor substrate 2 |
| Alias | FRS1A, FRS2A, FRS2alpha, SNT, SNT-1 |
| Introduction | Fibroblast growth factor receptor substrate 2 (FRS2, also called Suc-associated neurotrophic factor-induced tyrosine-phosphorylated target or SNT) participates in the transmission of extracellular signals from the fibroblast growth factor receptor (FGFR). Activation of the FGFR leads to tyrosine phosphorylation of FRS2. Two FRS2 family members have been identified, FRS2-alpha (SNT1) and FRS2-beta (SNT2) which are phosphorylated by these RTKs. Once they are phosphorylated, they recruit SH2 domain-containing proteins including Grb2 and SHP-2, mediating downstream signaling. Tyr436 is required for efficient SHP-2 recruitment whereas Tyr196 functions as a docking site for Grb2-Sos complexes. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human fibroblast growth factor receptor substrate 2. |
| NCBI Ref Seq | BC021562 |
| RefSeq ORF Size | 1539 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + NotI (6.1kb + 1.54kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.