Online Inquiry
FOXO4 cDNA ORF Clone, Human, untagged
SPD-05694
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human forkhead box O4. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | FoxO |
| Gene Abbr. | FOXO4 |
| Gene ID | 4303 |
| Full Name | forkhead box O4 |
| Alias | AFX, AFX1, MLLT7 |
| Introduction | The Forkhead family of transcription factors is involved in tumorigenesis of rhabdomyosarcoma and acute leukemias. Within the family, three members (FoxO1, FoxO4, and FoxO3a) have sequence similarity to the nematode orthologue DAF-16, which mediates signaling via a pathway involving IGFR1, PI3K, and Akt. Active forkhead members act as tumor suppressors by promoting cell cycle arrest and apoptosis. Increased expression of any FoxO member results in the activation of the cell cycle inhibitor p27 Kip1. Forkhead transcription factors also play a part in TGF-β-mediated upregulation of p21 Cip1, a process negatively regulated through PI3K. Increased proliferation results when forkhead transcription factors are inactivated through phosphorylation by Akt at Thr24, Ser256, and Ser319, which results in nuclear export and inhibition of transcription factor activity. Forkhead transcription factors can also be inhibited by the deacetylase sirtuin (SirT1). |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human forkhead box O4. |
| NCBI Ref Seq | NM_005938.3 |
| RefSeq ORF Size | 1518 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + NotI (6kb + 1.52kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.