Online Inquiry
FoxO3 cDNA ORF Clone, Human, untagged
SPD-05693
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human forkhead box O3 |
Target Information | |
---|---|
Species | Human |
Target Name | FoxO |
Gene Abbr. | FoxO3 |
Gene ID | 2309 |
Full Name | forkhead box O3 |
Alias | AF6q21, FKHRL1, FKHRL1P2, FOXO2, FOXO3A |
Introduction | Forkhead box O3 (FoxO3) is a ubiquitously expressed 72 kDa transcriptional regulator that is involved in cellular differentiation, angiogenesis, tumor progression, apoptosis, and the responses to oxidative stress and DNA damage. Phosphorylation of FoxO3 by Akt induces its association with 14-3-3 proteins and its retention in the cytoplasm. In response to the loss of survival factors, dephosphorylation of FoxO3 induces its translocation to the nucleus where it promotes apoptosis. Its level of acetylation is regulated in response to cellular metabolic requirements. Within amino acids 372‑673 (C-terminal to the DNA binding domain), human FoxO3 shares 95% aa sequence identity with mouse and rat FoxO3. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human forkhead box O3 |
NCBI Ref Seq | NM_001455.3 |
RefSeq ORF Size | 2022 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV mammalian cell promoter |
Restriction Sites | KpnI + XbaI (6.1kb + 2.02kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.