Online Inquiry
FOS Knockout Cell Line
SPL-01419
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | c-Fos |
| Gene Abbr. | FOS |
| Gene ID | 2353 |
| Full Name | Fos proto-oncogene, AP-1 transcription factor subunit |
| Alias | AP-1, C-FOS, p55 |
| Species | Human |
| Genomic Locus | chr14:75279927 |
| Transcript | NM_005252 |
| WT Expression Level | 2.04 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. In some cases, expression of the FOS gene has also been associated with apoptotic cell death. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of FOS. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CACTGCCATCTCGACCAGTC |
| PCR Primer |
Forward: ATTTAAGATGAAATGTCCGTGGCAG Reverse: CTAGAGTTCCTCACCTGTTCCAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.