FOS cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

FOS cDNA ORF Clone, Human, N-Myc tag

FOS cDNA ORF Clone, Human, N-Myc tag

SPD-03290

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human v-fos FBJ murine osteosarcoma viral oncogene homolog with N terminal Myc tag.
Target Information
Species Human
Target Name c-Fos
Gene Abbr. FOS
Gene ID 2353
Full Name Fos proto-oncogene, AP-1 transcription factor subunit
Alias AP-1, C-FOS, p55
Introduction The Fos family of nuclear oncogenes includes c-Fos, FosB, Fos-related antigen 1 (FRA1), and Fos-related antigen 2 (FRA2). While most Fos proteins exist as a single isoform, the FosB protein exists as two isoforms: full-length FosB and a shorter form, FosB2 (Delta FosB), which lacks the carboxy-terminal 101 amino acids. The expression of Fos proteins is rapidly and transiently induced by a variety of extracellular stimuli including growth factors, cytokines, neurotransmitters, polypeptide hormones, and stress. Fos proteins dimerize with Jun proteins (c-Jun, JunB, and JunD) to form Activator Protein-1 (AP-1), a transcription factor that binds to TRE/AP-1 elements and activates transcription. Fos and Jun proteins contain the leucine-zipper motif that mediates dimerization and an adjacent basic domain that binds to DNA. The various Fos/Jun heterodimers differ in their ability to transactivate AP-1 dependent genes. In addition to increased expression, phosphorylation of Fos proteins by Erk kinases in response to extracellular stimuli may further increase transcriptional activity. Phosphorylation of c-Fos at Ser32 and Thr232 by Erk5 increases protein stability and nuclear localization. Phosphorylation of FRA1 at Ser252 and Ser265 by Erk1/2 increases protein stability and leads to overexpression of FRA1 in cancer cells. Following growth factor stimulation, expression of FosB and c-Fos in quiescent fibroblasts is immediate, but very short-lived, with protein levels dissipating after several hours. FRA1 and FRA2 expression persists longer, and appreciable levels can be detected in asynchronously growing cells. Deregulated expression of c-Fos, FosB, or FRA2 can result in neoplastic cellular transformation; however, Delta FosB lacks the ability to transform cells.
Product Details
Description Full length Clone DNA of Human v-fos FBJ murine osteosarcoma viral oncogene homolog with N terminal Myc tag.
NCBI Ref Seq NM_005252.3
RefSeq ORF Size 1188 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 252C/T not causing the amino acid variation.
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 1.19kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.