Online Inquiry
FOS cDNA ORF Clone, Human, C-HA tag
SPD-03287
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human v-fos FBJ murine osteosarcoma viral oncogene homolog with C terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | c-Fos |
Gene Abbr. | FOS |
Gene ID | 2353 |
Full Name | Fos proto-oncogene, AP-1 transcription factor subunit |
Alias | AP-1, C-FOS, p55 |
Introduction | The Fos family of nuclear oncogenes includes c-Fos, FosB, Fos-related antigen 1 (FRA1), and Fos-related antigen 2 (FRA2). While most Fos proteins exist as a single isoform, the FosB protein exists as two isoforms: full-length FosB and a shorter form, FosB2 (Delta FosB), which lacks the carboxy-terminal 101 amino acids. The expression of Fos proteins is rapidly and transiently induced by a variety of extracellular stimuli including growth factors, cytokines, neurotransmitters, polypeptide hormones, and stress. Fos proteins dimerize with Jun proteins (c-Jun, JunB, and JunD) to form Activator Protein-1 (AP-1), a transcription factor that binds to TRE/AP-1 elements and activates transcription. Fos and Jun proteins contain the leucine-zipper motif that mediates dimerization and an adjacent basic domain that binds to DNA. The various Fos/Jun heterodimers differ in their ability to transactivate AP-1 dependent genes. In addition to increased expression, phosphorylation of Fos proteins by Erk kinases in response to extracellular stimuli may further increase transcriptional activity. Phosphorylation of c-Fos at Ser32 and Thr232 by Erk5 increases protein stability and nuclear localization. Phosphorylation of FRA1 at Ser252 and Ser265 by Erk1/2 increases protein stability and leads to overexpression of FRA1 in cancer cells. Following growth factor stimulation, expression of FosB and c-Fos in quiescent fibroblasts is immediate, but very short-lived, with protein levels dissipating after several hours. FRA1 and FRA2 expression persists longer, and appreciable levels can be detected in asynchronously growing cells. Deregulated expression of c-Fos, FosB, or FRA2 can result in neoplastic cellular transformation; however, Delta FosB lacks the ability to transform cells. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human v-fos FBJ murine osteosarcoma viral oncogene homolog with C terminal HA tag. |
NCBI Ref Seq | NM_005252.3 |
RefSeq ORF Size | 1185 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 252C/T not causing the amino acid variation. |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Restriction Sites | KpnI + XbaI (6kb + 1.19kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.