FNDC5 Knockout Cell Line - CD BioSciences

service-banner

FNDC5 Knockout Cell Line

FNDC5 Knockout Cell Line

SPL-01417

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name FNDC5
Gene Abbr. FNDC5
Gene ID 252995
Full Name fibronectin type III domain containing 5
Alias FRCP2, irisin
Species Human
Genomic Locus chr1:32868323
Transcript NM_001171940
WT Expression Level 5.72 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a secreted protein that is released from muscle cells during exercise. The encoded protein may participate in the development of brown fat. Translation of the precursor protein initiates at a non-AUG start codon at a position that is conserved as an AUG start codon in other organisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of FNDC5.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence CCACCCGCTCATGTGCCCTC
PCR Primer Forward: CTTTGTTCTTGGAGGCCATCTTCTC
Reverse: TTGTGTATGTAAAGGCTTTGTCACC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.