Online Inquiry
FN1 Knockout Cell Line
SPL-01415
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
11bp deletion |
Target Information | |
---|---|
Target Name | Fibronectin |
Gene Abbr. | FN1 |
Gene ID | 2335 |
Full Name | fibronectin 1 |
Alias | CIG, ED-B, FINC, FN, FNZ |
Species | Human |
Genomic Locus | chr2:215434753 |
Transcript | NM_212476 |
WT Expression Level | 6.16 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes fibronectin, a glycoprotein present in a soluble dimeric form in plasma, and in a dimeric or multimeric form at the cell surface and in extracellular matrix. The encoded preproprotein is proteolytically processed to generate the mature protein. Fibronectin is involved in cell adhesion and migration processes including embryogenesis, wound healing, blood coagulation, host defense, and metastasis. The gene has three regions subject to alternative splicing, with the potential to produce 20 different transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. The full-length nature of some variants has not been determined. [provided by RefSeq, Jan 2016]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of FN1. |
Description | 11bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GACCTACCTAGGCAATGCGT |
PCR Primer |
Forward: TGCAAAGTTTAACAATTACCACTTC Reverse: ACTTCAATTGTCTGCCTTCCAAAAT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.