Online Inquiry
FMR1 Knockout Cell Line
SPL-01411
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 13bp deletion |
| Target Information | |
|---|---|
| Target Name | FMR1 |
| Gene Abbr. | FMR1 |
| Gene ID | 2332 |
| Full Name | FMRP translational regulator 1 |
| Alias | FMRP, FRAXA, POF, POF1 |
| Species | Human |
| Genomic Locus | chrX:147929956 |
| Transcript | NM_001185076 |
| WT Expression Level | 63.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene binds RNA and is associated with polysomes. The encoded protein may be involved in mRNA trafficking from the nucleus to the cytoplasm. A trinucleotide repeat (CGG) in the 5' UTR is normally found at 6-53 copies, but an expansion to 55-230 repeats is the cause of fragile X syndrome. Expansion of the trinucleotide repeat may also cause one form of premature ovarian failure (POF1). Multiple alternatively spliced transcript variants that encode different protein isoforms and which are located in different cellular locations have been described for this gene. [provided by RefSeq, May 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of FMR1. |
| Description | 13bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATCCTTATGTGCCGCCTCTT |
| PCR Primer |
Forward: TGTCTCTTTTGGTAATCTAAGCTGT Reverse: CTTTGAGGTGACTTCATTGATGGAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.