Online Inquiry
FGF1 cDNA ORF Clone, Rhesus, C-HA tag
SPD-05645
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rhesus fibroblast growth factor 1 (acidic) with C terminal HA tag. |
Target Information | |
---|---|
Species | Rhesus |
Target Name | FGF |
Gene Abbr. | FGF1 |
Gene ID | 705970 |
Full Name | fibroblast growth factor 1 |
Introduction | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Three alternatively spliced variants encoding different isoforms have been described. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rhesus fibroblast growth factor 1 (acidic) with C terminal HA tag. |
NCBI Ref Seq | XM_001095895.2 |
RefSeq ORF Size | 468 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.