FGF1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

FGF1 cDNA ORF Clone, Human, untagged

FGF1 cDNA ORF Clone, Human, untagged

SPD-05680

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human fibroblast growth factor 1 (acidic). This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
Target Information
Species Human
Target Name FGF
Gene Abbr. FGF1
Gene ID 2246
Full Name fibroblast growth factor 1
Alias AFGF, ECGF, ECGF-beta, ECGFA, ECGFB, FGF-1, FGF-alpha, FGFA, GLIO703, HBGF-1, HBGF1
Introduction The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Three alternatively spliced variants encoding different isoforms have been described.
Product Details
Description Full length Clone DNA of Human fibroblast growth factor 1 (acidic). This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
RefSeq ORF Size 468 bp
Sequence Information A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in E. coli system.The translated amino acid sequence is identical with NP_000791.1.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.47kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.