Online Inquiry
FGF1 cDNA ORF Clone, Human, N-Myc tag
SPD-05678
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human fibroblast growth factor 1 (acidic) with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | FGF |
| Gene Abbr. | FGF1 |
| Gene ID | 2246 |
| Full Name | fibroblast growth factor 1 |
| Alias | AFGF, ECGF, ECGF-beta, ECGFA, ECGFB, FGF-1, FGF-alpha, FGFA, GLIO703, HBGF-1, HBGF1 |
| Introduction | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Jan 2009] |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human fibroblast growth factor 1 (acidic) with N terminal Myc tag. |
| RefSeq ORF Size | 468 bp |
| Sequence Information | A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in E. coli system.The translated amino acid sequence is identical with NP_000791.1. |
| Vector | pCMV3-SP-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.