FGF1 cDNA ORF Clone, Canine, C-Myc tag - CD BioSciences

service-banner

FGF1 cDNA ORF Clone, Canine, C-Myc tag

FGF1 cDNA ORF Clone, Canine, C-Myc tag

SPD-05654

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Canine fibroblast growth factor 1 (acidic) with C terminal Myc tag.
Target Information
Species Canine
Target Name FGF
Gene Abbr. FGF1
Gene ID 607724
Full Name fibroblast growth factor 1
Introduction The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Three alternatively spliced variants encoding different isoforms have been described.
Product Details
Description Full length Clone DNA of Canine fibroblast growth factor 1 (acidic) with C terminal Myc tag.
NCBI Ref Seq XM_844181.2
RefSeq ORF Size 465 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.