Fermt2 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Fermt2 cDNA ORF Clone, Rat, untagged

Fermt2 cDNA ORF Clone, Rat, untagged

SPD-05631

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat fermitin family member 2.
Target Information
Species Rat
Target Name FERMT2
Gene Abbr. Fermt2
Gene ID 289992
Full Name fermitin family member 2
Alias Plekhc1
Product Details
Description Full length Clone DNA of Rat fermitin family member 2.
NCBI Ref Seq XM_006251760.2
RefSeq ORF Size 2064 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.