FCGR2B cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

FCGR2B cDNA ORF Clone, Rhesus, untagged

FCGR2B cDNA ORF Clone, Rhesus, untagged

SPD-05600

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus Fc fragment of IgG, low affinity IIa, receptor.
Target Information
Species Rhesus
Target Name FCGR2B
Gene Abbr. FCGR2B
Gene ID 720009
Full Name Fc fragment of IgG receptor IIb
Product Details
Description Full length Clone DNA of Rhesus Fc fragment of IgG, low affinity IIa, receptor.
NCBI Ref Seq XM_001118066.2
RefSeq ORF Size 948 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.