FCGR2B cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

FCGR2B cDNA ORF Clone, Human, untagged

FCGR2B cDNA ORF Clone, Human, untagged

SPD-05620

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human Fc fragment of IgG, low affinity IIa, receptor (CD32), transcript variant 1.
Target Information
Species Human
Target Name FCGR2B
Gene Abbr. FCGR2B
Gene ID 2213
Full Name Fc fragment of IgG receptor IIb
Alias CD32, CD32B, FCG2, FCGR2, FCGR2C
Product Details
Description Full length Clone DNA of Human Fc fragment of IgG, low affinity IIa, receptor (CD32), transcript variant 1.
NCBI Ref Seq NM_001136219.1
RefSeq ORF Size 954 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutation 600 T/C not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.95kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.