FBXW7 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

FBXW7 cDNA ORF Clone, Human, untagged

FBXW7 cDNA ORF Clone, Human, untagged

SPD-05570

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human F-box and WD repeat domain containing 7.
Target Information
Species Human
Target Name FBXW7
Gene Abbr. FBXW7
Gene ID 55294
Full Name F-box and WD repeat domain containing 7
Alias AGO, CDC4, FBW6, FBW7, FBX30
Product Details
Description Full length Clone DNA of Human F-box and WD repeat domain containing 7.
NCBI Ref Seq NM_033632.2
RefSeq ORF Size 2124 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 2.12kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.