FBXW11 Knockout Cell Line - CD BioSciences

service-banner

FBXW11 Knockout Cell Line

FBXW11 Knockout Cell Line

SPL-01366

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name FBXW11
Gene Abbr. FBXW11
Gene ID 23291
Full Name F-box and WD repeat domain containing 11
Alias BTRC2, BTRCP2, FBW1B, FBXW1B, Fbw11
Species Human
Genomic Locus chr5:171891563
Transcript NM_033644
WT Expression Level 28.95 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of FBXW11.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence GTGGACGACACAACTTGCAG
PCR Primer Forward: TGCCAAGATTGAGTGGAAGAGATAA
Reverse: CACAGACAGTTATGCAAACCAAGAT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.