Online Inquiry
FASN Knockout Cell Line
SPL-01358
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | Fatty Acid Synthase |
| Gene Abbr. | FASN |
| Gene ID | 2194 |
| Full Name | fatty acid synthase |
| Alias | FAS, OA-519, SDR27X1 |
| Species | Human |
| Genomic Locus | chr17:82095436 |
| Transcript | NM_004104 |
| WT Expression Level | 135.98 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of FASN. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTCAGCTTGCCGGACCGCCG |
| PCR Primer |
Forward: AGAAGAGAAAACACTGCCTATTCCA Reverse: CATAGCAGAGAGTCCTCAGTTCCAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.