FASN Knockout Cell Line - CD BioSciences

service-banner

FASN Knockout Cell Line

FASN Knockout Cell Line

SPL-01357

Size Price
1 Unit Online Inquiry
Description
26bp deletion
Target Information
Target Name Fatty Acid Synthase
Gene Abbr. FASN
Gene ID 2194
Full Name fatty acid synthase
Alias FAS, OA-519, SDR27X1
Species Human
Genomic Locus chr17:82095436
Transcript NM_004104
WT Expression Level 135.98 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 26bp deletion in a coding exon of FASN.
Description 26bp deletion
Parental Cell Line C631
Guide RNA Sequence TTCAGCTTGCCGGACCGCCG
PCR Primer Forward: AGAAGAGAAAACACTGCCTATTCCA
Reverse: CATAGCAGAGAGTCCTCAGTTCCAC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.