FASLG cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

FASLG cDNA ORF Clone, Human, C-Myc tag

FASLG cDNA ORF Clone, Human, C-Myc tag

SPD-05533

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human Fas ligand (TNF superfamily, member 6) with C terminal Myc tag.
Target Information
Species Human
Target Name FasL
Gene Abbr. FASLG
Gene ID 356
Full Name Fas ligand
Alias ALPS1B, APT1LG1, APTL, CD178, CD95-L
Introduction Association of the receptor Fas with its ligand FasL triggers an apoptotic pathway that plays an important role in immune regulation, development, and progression of cancers. Loss of function mutation in either Fas (lpr mice) or FasL (gld mice) leads to lymphadenopathy and splenomegaly as a result of decreased apoptosis in CD4-CD8- T lymphocytes. FasL (CD95L, Apo-1L) is a type II transmembrane protein of 280 amino acids (runs at approximately 40 kDa upon glycosylation) that belongs to the TNF family, which also includes TNF-α, TRAIL, and TWEAK. Binding of FasL to its receptor triggers the formation of a death-inducing signaling complex (DISC) involving the recruitment of the adaptor protein FADD and caspase-8. Activation of caspase-8 from this complex initiates a caspase cascade resulting in the activation of caspase-3 and subsequent cleavage of proteins leading to apoptosis. Unlike Fas, which is constitutively expressed by various cell types, FasL is predominantly expressed on activated T lymphocytes, NK cells, and at immune privileged sites. FasL is also expressed in several tumor types as a mechanism to evade immune surveillance. Similar to other members of the TNF family, FasL can be cleaved by metalloproteinases producing a 26 kDa trimeric soluble form.
Product Details
Description Full length Clone DNA of Human Fas ligand (TNF superfamily, member 6) with C terminal Myc tag.
NCBI Ref Seq BC017502
RefSeq ORF Size 846 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.