Online Inquiry
FANCB Knockout Cell Line
SPL-01342
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | FANCB |
| Gene Abbr. | FANCB |
| Gene ID | 2187 |
| Full Name | FA complementation group B |
| Alias | FA2, FAAP90, FAAP95, FAB, FACB |
| Species | Human |
| Genomic Locus | chrX:14864716 |
| Transcript | NM_001018113 |
| WT Expression Level | 7.94 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the Fanconi anemia complementation group B. This protein is assembled into a nucleoprotein complex that is involved in the repair of DNA lesions. Mutations in this gene can cause chromosome instability and VACTERL syndrome with hydrocephalus. [provided by RefSeq, Apr 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of FANCB. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAGCTGATTCTTTCGAGTAA |
| PCR Primer |
Forward: TCTGAGGAAGAATGTACTCAAGAGC Reverse: CCATACAGCACAAGCATTATTGGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.