FANCA Knockout Cell Line - CD BioSciences

service-banner

FANCA Knockout Cell Line

FANCA Knockout Cell Line

SPL-01340

Size Price
1 Unit Online Inquiry
Description
2bp insertion
Target Information
Target Name FANCA
Gene Abbr. FANCA
Gene ID 2175
Full Name FA complementation group A
Alias FA, FA-H, FA1, FAA, FACA
Species Human
Genomic Locus chr16:89810994
Transcript NM_001018112
WT Expression Level 73.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of FANCA.
Description 2bp insertion
Parental Cell Line C631
Guide RNA Sequence CGGGATGGTTGCCTCTAGCG
PCR Primer Forward: ATACTGAGCAAACTCTAACAGGGAA
Reverse: GGCATTTTAAACAGCAAGTCTTTGG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.