FADS1 Knockout Cell Line - CD BioSciences

service-banner

FADS1 Knockout Cell Line

FADS1 Knockout Cell Line

SPL-01327

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name FADS1
Gene Abbr. FADS1
Gene ID 3992
Full Name fatty acid desaturase 1
Alias D5D, FADS6, FADSD5, LLCDL1, TU12
Species Human
Genomic Locus chr11:61813325
Transcript NM_013402
WT Expression Level 144.78 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of FADS1.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence GTGGCCTTCCACATCAACAA
PCR Primer Forward: GTGACCTCATGACTATGCAAGAGAA
Reverse: TCAACTTGGGTACAGCCTTCTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.