Fadd cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Fadd cDNA ORF Clone, Mouse, untagged

Fadd cDNA ORF Clone, Mouse, untagged

SPD-05438

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse Fas (TNFRSF6)-associated via death domain.
Target Information
Species Mouse
Target Name FADD
Gene Abbr. Fadd
Gene ID 14082
Full Name Fas (TNFRSF6)-associated via death domain
Alias Mort1/F, Mort1/FADD
Introduction Fas-associated death domain (FADD or Mort 1) functions as an important adaptor in coupling death signaling from membrane receptors, such as the Fas ligand and TNF family (DR3, DR4 and DR5), to caspase-8. FADD has a carboxy-terminal death domain, which interacts with the cytoplasmic tail of the membrane receptor, and an amino-terminal death effector domain, which interacts with caspase-8. Clustering of the receptors upon stimulation brings about FADD and caspase-8 oligomerization, activating the caspase signaling pathway. Human FADD is phosphorylated mainly at Ser194, while mouse FADD is phosphorylated at Ser191. In both cases, the phosphorylation is cell cycle-dependent and may be related to its regulatory role in embryonic development and cell cycle progression.
Product Details
Description Full length Clone DNA of Mouse Fas (TNFRSF6)-associated via death domain.
NCBI Ref Seq NM_010175.5
RefSeq ORF Size 618 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.