Online Inquiry
Fadd cDNA ORF Clone, Mouse, C-HA tag
SPD-05432
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse Fas (TNFRSF6)-associated via death domain with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | FADD |
| Gene Abbr. | Fadd |
| Gene ID | 14082 |
| Full Name | Fas (TNFRSF6)-associated via death domain |
| Alias | Mort1/F, Mort1/FADD |
| Introduction | Fas-associated death domain (FADD or Mort 1) functions as an important adaptor in coupling death signaling from membrane receptors, such as the Fas ligand and TNF family (DR3, DR4 and DR5), to caspase-8. FADD has a carboxy-terminal death domain, which interacts with the cytoplasmic tail of the membrane receptor, and an amino-terminal death effector domain, which interacts with caspase-8. Clustering of the receptors upon stimulation brings about FADD and caspase-8 oligomerization, activating the caspase signaling pathway. Human FADD is phosphorylated mainly at Ser194, while mouse FADD is phosphorylated at Ser191. In both cases, the phosphorylation is cell cycle-dependent and may be related to its regulatory role in embryonic development and cell cycle progression. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse Fas (TNFRSF6)-associated via death domain with C terminal HA tag. |
| NCBI Ref Seq | NM_010175.5 |
| RefSeq ORF Size | 618 bp |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.