Online Inquiry
F2RL1 Knockout Cell Line
SPL-01326
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | PAR2 |
| Gene Abbr. | F2RL1 |
| Gene ID | 2150 |
| Full Name | F2R like trypsin receptor 1 |
| Alias | GPR11, PAR2 |
| Species | Human |
| Genomic Locus | chr5:76832734 |
| Transcript | NM_005242 |
| WT Expression Level | 16.69 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the G-protein coupled receptor 1 family of proteins. The encoded cell surface receptor is activated through proteolytic cleavage of its extracellular amino terminus, resulting in a new amino terminus that acts as a tethered ligand that binds to an extracellular loop domain. Activation of the receptor has been shown to stimulate vascular smooth muscle relaxation, dilate blood vessels, increase blood flow, and lower blood pressure. This protein is also important in the inflammatory response, as well as innate and adaptive immunity. [provided by RefSeq, Jun 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of F2RL1. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GATGGCACATCCCACGTCAC |
| PCR Primer |
Forward: TGTACTTTCATTTGAACAAACCAGT Reverse: CTTAGTTCGGAAAAGAAAGACCCAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.