Online Inquiry
EZR Knockout Cell Line
SPL-01323
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | Ezrin |
| Gene Abbr. | EZR |
| Gene ID | 7430 |
| Full Name | ezrin |
| Alias | CVIL, CVL, HEL-S-105, VIL2 |
| Species | Human |
| Genomic Locus | chr6:158785526 |
| Transcript | NM_001111077 |
| WT Expression Level | 94.31 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The cytoplasmic peripheral membrane protein encoded by this gene functions as a protein-tyrosine kinase substrate in microvilli. As a member of the ERM protein family, this protein serves as an intermediate between the plasma membrane and the actin cytoskeleton. This protein plays a key role in cell surface structure adhesion, migration and organization, and it has been implicated in various human cancers. A pseudogene located on chromosome 3 has been identified for this gene. Alternatively spliced variants have also been described for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of EZR. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACTTGGCCCGGAACTTGAAC |
| PCR Primer |
Forward: AGACTTGTGCACTTCTTTGTTGTAG Reverse: TGTCTGGAGTGCTAAAAAGATGACT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.