EZR cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

EZR cDNA ORF Clone, Human, untagged

EZR cDNA ORF Clone, Human, untagged

SPD-05428

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human ezrin.
Target Information
Species Human
Target Name Ezrin
Gene Abbr. EZR
Gene ID 7430
Full Name ezrin
Alias CVIL, CVL, HEL-S-105, VIL2
Introduction The ezrin, radixin, and moesin (ERM) proteins function as linkers between the plasma membrane and the actin cytoskeleton and are involved in cell adhesion, membrane ruffling, and microvilli formation. ERM proteins undergo intra or intermolecular interaction between their amino- and carboxy-terminal domains, existing as inactive cytosolic monomers or dimers. Phosphorylation at a carboxy-terminal threonine residue (Thr567 of ezrin, Thr564 of radixin, Thr558 of moesin) disrupts the amino- and carboxy-terminal association and may play a key role in regulating ERM protein conformation and function. Phosphorylation at Thr567 of ezrin is required for cytoskeletal rearrangements and oncogene-induced transformation. Ezrin is also phosphorylated at tyrosine residues upon growth factor stimulation. Phosphorylation of Tyr353 of ezrin transmits a survival signal during epithelial differentiation.
Product Details
Description Full length Clone DNA of Human ezrin.
NCBI Ref Seq NM_001111077.1
RefSeq ORF Size 1761 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.76kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.