Online Inquiry
EZR cDNA ORF Clone, Human, N-HA tag
SPD-05426
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human ezrin with N terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Ezrin |
Gene Abbr. | EZR |
Gene ID | 7430 |
Full Name | ezrin |
Alias | CVIL, CVL, HEL-S-105, VIL2 |
Introduction | The ezrin, radixin, and moesin (ERM) proteins function as linkers between the plasma membrane and the actin cytoskeleton and are involved in cell adhesion, membrane ruffling, and microvilli formation. ERM proteins undergo intra or intermolecular interaction between their amino- and carboxy-terminal domains, existing as inactive cytosolic monomers or dimers. Phosphorylation at a carboxy-terminal threonine residue (Thr567 of ezrin, Thr564 of radixin, Thr558 of moesin) disrupts the amino- and carboxy-terminal association and may play a key role in regulating ERM protein conformation and function. Phosphorylation at Thr567 of ezrin is required for cytoskeletal rearrangements and oncogene-induced transformation. Ezrin is also phosphorylated at tyrosine residues upon growth factor stimulation. Phosphorylation of Tyr353 of ezrin transmits a survival signal during epithelial differentiation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human ezrin with N terminal HA tag. |
NCBI Ref Seq | NM_001111077.1 |
RefSeq ORF Size | 1761 bp |
Vector | pCMV3-SP-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.