Online Inquiry
EZH2 Knockout Cell Line
SPL-01318
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
13bp deletion |
Target Information | |
---|---|
Target Name | Ezh2 |
Gene Abbr. | EZH2 |
Gene ID | 2146 |
Full Name | enhancer of zeste 2 polycomb repressive complex 2 subunit |
Alias | ENX-1, ENX1, EZH2b, KMT6, KMT6A |
Species | Human |
Genomic Locus | chr7:148828832 |
Transcript | NM_001203247 |
WT Expression Level | 38.80 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of EZH2. |
Description | 13bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GTGGAGTTGGTGAATGCCCT |
PCR Primer |
Forward: GAAAGAAAGCTGTAATGGCTACACA Reverse: GTTACTAGGCTATGCCTGTTTTGTC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.