Online Inquiry
EZH1 Knockout Cell Line
SPL-01316
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | EZH1 |
| Gene Abbr. | EZH1 |
| Gene ID | 2145 |
| Full Name | enhancer of zeste 1 polycomb repressive complex 2 subunit |
| Alias | KMT6B |
| Species | Human |
| Genomic Locus | chr17:42727664 |
| Transcript | NM_001991 |
| WT Expression Level | 5.89 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | EZH1 is a component of a noncanonical Polycomb repressive complex-2 (PRC2) that mediates methylation of histone H3 (see MIM 602812) lys27 (H3K27) and functions in the maintenance of embryonic stem cell pluripotency and plasticity (Shen et al., 2008 [PubMed 19026780]).[supplied by OMIM, Mar 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of EZH1. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTTCATTGACTGAACAGGT |
| PCR Primer |
Forward: GAGCCACCATACCTTGTCTTACTTA Reverse: TCTTAATCTTTTCCATGGCTTTGCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.