EXO1 Knockout Cell Line - CD BioSciences

service-banner

EXO1 Knockout Cell Line

EXO1 Knockout Cell Line

SPL-01313

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name EXO1
Gene Abbr. EXO1
Gene ID 9156
Full Name exonuclease 1
Alias HEX1, hExoI
Species Human
Genomic Locus chr1:241852350
Transcript NM_130398
WT Expression Level 68.36 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a protein with 5' to 3' exonuclease activity as well as an RNase H activity. It is similar to the Saccharomyces cerevisiae protein Exo1 which interacts with Msh2 and which is involved in mismatch repair and recombination. Alternative splicing of this gene results in three transcript variants encoding two different isoforms. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of EXO1.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence CATCCATCAAATACGAGAAT
PCR Primer Forward: CTCGTAAGTATCCAAGGCAGGATTT
Reverse: ATCATAGGGTACTAAGGTGCTGAAC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.