ETS1 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

ETS1 cDNA ORF Clone, Human, N-HA tag

ETS1 cDNA ORF Clone, Human, N-HA tag

SPD-05405

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) with N terminal HA tag.
Target Information
Species Human
Target Name ETS-1
Gene Abbr. ETS1
Gene ID 2113
Full Name ETS proto-oncogene 1, transcription factor
Alias ETS-1, EWSR2, c-ets-1, p54
Introduction ETS-1 is a proto-oncoprotein that belongs to the E26 Transformation-specific Sequence (ETS) family of transcription factors that share a unique and highly conserved DNA binding domain. ETS-1 plays important roles in vascular development and angiogenesis and vascular inflammation and remodeling. The target genes of ETS-1 include receptor tyrosine kinases, MMPs, and cell adhesion molecules. In addition, ETS-1 is involved in regulation of energy metabolism in cancer cells. ETS-1 activity is regulated by two different types of phosphorylation sites. While phosphorylation at a cluster of serine residues in the exon VII domain by CaMKII inhibits ETS-1 DNA binding activity phosphorylation at its Thr38 site by Ras activates ETS-1.
Product Details
Description Full length Clone DNA of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) with N terminal HA tag.
NCBI Ref Seq NM_001143820
RefSeq ORF Size 1500 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites HindIII + NotI (6kb + 1.5kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.