Online Inquiry
ETS1 cDNA ORF Clone, Human, C-HA tag
SPD-05400
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | ETS-1 |
| Gene Abbr. | ETS1 |
| Gene ID | 2113 |
| Full Name | ETS proto-oncogene 1, transcription factor |
| Alias | ETS-1, EWSR2, c-ets-1, p54 |
| Introduction | ETS-1 is a proto-oncoprotein that belongs to the E26 Transformation-specific Sequence (ETS) family of transcription factors that share a unique and highly conserved DNA binding domain. ETS-1 plays important roles in vascular development and angiogenesis and vascular inflammation and remodeling. The target genes of ETS-1 include receptor tyrosine kinases, MMPs, and cell adhesion molecules. In addition, ETS-1 is involved in regulation of energy metabolism in cancer cells. ETS-1 activity is regulated by two different types of phosphorylation sites. While phosphorylation at a cluster of serine residues in the exon VII domain by CaMKII inhibits ETS-1 DNA binding activity phosphorylation at its Thr38 site by Ras activates ETS-1. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) with C terminal HA tag. |
| NCBI Ref Seq | NM_001143820 |
| RefSeq ORF Size | 1458 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + NotI (6kb + 1.5kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.