Online Inquiry
ESR1 cDNA ORF Clone, Human, untagged
SPD-05376
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human estrogen receptor 1. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Estrogen Receptor α |
| Gene Abbr. | ESR1 |
| Gene ID | 2099 |
| Full Name | estrogen receptor 1 |
| Alias | ER, ESR, ESRA, ESTRR, Era |
| Introduction | Estrogen receptor α (ERα), a member of the steroid receptor superfamily, contains highly conserved DNA binding and ligand binding domains. Through its estrogen-independent and estrogen-dependent activation domains (AF-1 and AF-2, respectively), ERα regulates transcription by recruiting coactivator proteins and interacting with general transcriptional machinery. Phosphorylation at multiple sites provides an important mechanism to regulate ERα activity. Ser104, 106, 118, and 167 are located in the amino-terminal transcription activation function domain AF-1, and phosphorylation of these serine residues plays an important role in regulating ERα activity. Ser118 may be the substrate of the transcription regulatory kinase CDK7. Ser167 may be phosphorylated by p90RSK and Akt. According to the research literature, phosphorylation at Ser167 may confer tamoxifen resistance in breast cancer patients. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human estrogen receptor 1. |
| NCBI Ref Seq | NM_001122742.1 |
| RefSeq ORF Size | 1788 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + ApaI (6.1kb + 1.79kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.